Exons and Introns Classifier
GPT-2 finetuned model for classifying DNA sequences into introns and exons, trained on a large cross-species GenBank dataset (34,627 different species).
Model Architecture
- Base model: GPT-2
- Approach: Full-sequence classification
Usage
You can use this model through its own custom pipeline:
from transformers import pipeline
pipe = pipeline(
task="gpt2-exon-intron-classification",
model="GustavoHCruz/ExInGPT",
trust_remote_code=True,
)
out = pipe(
{
"sequence": "GCAGCAACAGTGCCCAGGGCTCTGATGAGTCTCTCATCACTTGTAAAG",
"organism": "Homo sapiens",
"gene": "HLA-C",
"before": "GGTCTTTTTTTTTGTTCTACCCCAG",
"after": "GTGAGATTCTGGGGAGCTGAAGTGG",
}
)
print(out) # EXON
This model uses the same maximum context length as the standard GPT‑2 (1024 tokens), but it was trained on DNA sequences of up to 512 nucleotides. Additional context information (organism, gene, before, after) was also trained using specific rules:
- Organism and gene names were truncated to 10 characters
- Flanking sequences
beforeandafterwere up to 25 nucleotides.
The pipeline follows these rules. Nucleotide sequences, organism, gene, before and after, will be automatically truncated if they exceed the limit.
Custom Usage Information
Prompt format:
The model expects the following input format:
<|SEQUENCE|>[G][C][A][G]...
<|ORGANISM|>Homo sapiens
<|GENE|>HLA-C
<|FLANK_BEFORE|>[G][G][T][C]...
<|FLANK_AFTER|>[G][T][G][A]...
<|TARGET|>
<|SEQUENCE|>: Full DNA sequence. Maximum of 512 nucleotides.<|ORGANISM|>: Optional organism name (truncated to a maximum of 10 characters in training).<|GENE|>: Optional gene name (truncated to a maximum of 10 characters in training).<|FLANK_BEFORE|>and<|FLANK_AFTER|>: Optional upstream/downstream context sequences. Maximum of 25 nucleotides.<|TARGET|>: Separation token for label prediction.
The model should predict the next token as the class label: [EXON] or [INTRON].
Dataset
The model was trained on a processed version of GenBank sequences spanning multiple species, available at the DNA Coding Regions Dataset.
Publications
- Full Paper
Achieved 2nd place at the Symposium on Knowledge Discovery, Mining and Learning (KDMiLe 2025), organized by the Brazilian Computer Society (SBC), held in Fortaleza, Ceará, Brazil.
DOI: https://doi.org/10.5753/kdmile.2025.247575. - Short Paper
Presented at the IEEE International Conference on Bioinformatics and BioEngineering (BIBE 2025), held in Athens, Greece.
DOI: https://doi.org/10.1109/BIBE66822.2025.00113.
Training
- Trained on an architecture with 8x H100 GPUs.
Metrics
Average accuracy: 0.9985
| Class | Precision | Recall | F1-Score |
|---|---|---|---|
| Intron | 0.9977 | 0.9973 | 0.9975 |
| Exon | 0.9988 | 0.9990 | 0.9989 |
Notes
- Metrics were computed on a full isolated test set.
- The classes follow a ratio of approximately 2 exons to one intron, allowing for direct interpretation of the scores.
- The model can operate on raw nucleotide sequences without additional biological features (e.g. organism, gene, before or after).
GitHub Repository
The full code for data processing, model training, and inference is available on GitHub:
CodingDNATransformers
You can find scripts for:
- Preprocessing GenBank sequences
- Fine-tuning models
- Evaluating and using the trained models
- Downloads last month
- 58
Model tree for GustavoHCruz/ExInGPT
Base model
openai-community/gpt2